Advertisement

Noncoding RNA helps protein binding

Besides reading the coding regions of genes, RNA polymerase generates RNA at promoter-proximal and -distal DNA elements, but the function of these molecules is largely unknown. Sigova et al. show that these RNAs facilitate interactions between gene regulators and the regulatory elements they occupy. Nascent RNA associates with the transcription factor YY1 and increases its ability to bind DNA. Thus, transcription at active regulatory elements may provide a positive feedback loop that reinforces regulatory elements contributing to the stability of gene expression programs.
Science, this issue p. 978

Abstract

Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs.
Active promoter and enhancer elements are transcribed bidirectionally (Fig. 1A) (13). Although various models have been proposed for the roles of RNA species produced from these regulatory elements, their functions are not fully understood (413). Evidence that some DNA binding transcription factors (TFs) also bind RNA (14, 15) led us to consider the possibility that there might be a direct and general role for promoter-proximal and -distal enhancer RNA in the binding and maintenance of TFs at regulatory elements.
Fig. 1 YY1 binds to DNA and RNA at transcriptional regulatory elements.
(A) Cartoon depicting divergent transcription at enhancers and promoters in mammalian cells. eRNA, enhancer RNA; ncRNA, noncoding RNA; RNA Pol II, RNA polymerase II. (B) Alignment of GRO-seq reads at all enhancers and promoters in ESCs. Enhancers were defined as in (23). The x axis indicates distance from either the enhancer center (C) or the transcription start site (TSS) in kilobases. The y axis indicates average density of uniquely mapped GRO-seq reads per genomic bin. (C) Gene tracks for the Arid1a gene and enhancer, showing ChIP-seq and CLIP-seq data, as well as GRO-seq reads for murine ESCs. kb, kilobases. (D) Mean read density of YY1 ChIP-seq and CLIP-seq reads at enhancers and promoters of all National Center for Biotechnology Information RefSeq genes in ESCs.
We used global run-on sequencing (GRO-seq) to sequence nascent transcripts in murine embryonic stem cells (ESCs) at great depth, which confirmed that active promoter and enhancer elements are generally transcribed bidirectionally (Fig. 1B, fig. S1A, and table S1) (see also supplementary materials and methods). We then focused our studies on the TF Yin-Yang 1 (YY1), because it is ubiquitously expressed in mammalian cells, plays key roles in normal development, and can bind RNA species in vitro (15, 16). Chromatin immunoprecipitation sequencing (ChIP-seq) analysis in ESCs revealed that YY1 binds to both active enhancers and promoters, with some preference for promoters (Fig. 1, C and D, fig. S1, and table S2). In contrast, the pluripotency TF OCT4 preferentially occupies enhancers (fig. S1B). Consistent with this, YY1 sequence motifs were enriched at promoters, whereas OCT4 motifs were enriched at enhancers (fig. S1B). Neither YY1 nor OCT4 occupied the promoter-proximal sequences of inactive genes (fig. S2). These results establish that YY1 generally occupies active enhancer and promoter-proximal elements in ESCs.
We next used cross-linking immunoprecipitation sequencing (CLIP-seq) in ESCs to investigate YY1 binding to RNA in vivo (figs. S3 and S4 and table S3). Our results showed that YY1 binds RNA species at the active enhancer and promoter regions where it is bound to DNA (Fig. 1, C and D, and fig. S1C). At promoters, YY1 preferentially occupied RNA downstream rather than upstream of transcription start sites (fig. S1B), consistent with YY1 motif distribution and evidence that upstream noncoding RNA is unstable (3, 17, 18). In similar experiments with OCT4, substantial levels of RNA binding were not observed (fig. S5). These results suggest that YY1 generally binds to RNA species transcribed from enhancers and promoters in vivo.
The DNA and RNA binding properties of YY1 were further investigated in vitro (Fig. 2 and figs. S6 to S8). The recombinant YY1 protein bound both DNA and RNA probes in electrophoretic mobility shift assays (EMSA), showing greater affinity for DNA than for RNA. The affinity of YY1 varied for different RNA sequences (fig. S8). The four YY1 zinc fingers can bind DNA (19), but the portion of YY1 that interacts with RNA is unknown. The zinc finger–containing C-terminal region and the N-terminal region of YY1 were purified, and their DNA and RNA binding properties were further investigated (fig. S9). The zinc finger region of YY1 bound to DNA but not to RNA, whereas the N-terminal region of YY1 bound to RNA (fig. S9). Furthermore, the DNA probe did not compete efficiently with the RNA probe for YY1 binding (figs. S7C and S8C). These results suggest that different regions of YY1 are responsible for binding to DNA and RNA.
Fig. 2 YY1 binds to DNA and RNA in vitro.
(A) (Left) EMSA of YY1-DNA complexes at different concentrations of recombinant YY1. A radioactively labeled 30-bp DNA probe (5 nM), derived from the promoter region of the Arid1a gene containing a consensus YY1 binding motif (CTCTTCTCTCTTAAAATGGCTGCCTGTCTG), was incubated with increasing concentrations of recombinant YY1 protein. (Right) EMSA of YY1-RNA complexes at different concentrations of recombinant YY1. A radioactively labeled 30-nt RNA probe (5 nM) derived from the same region of the Arid1a gene was incubated with increasing concentrations of recombinant YY1 protein. (B) Graph depicting the relation between the fraction of bound radioactively labeled DNA or RNA probe and the concentration of recombinant YY1 in the binding reaction. Error bars indicate SDs from the mean values.
The observation that YY1 binds to enhancer and promoter-proximal elements and to RNA transcribed from those regions led us to postulate that nascent RNA contributes to stable TF occupancy at these regulatory elements (Fig. 3A). If this model is correct, then reduced levels of nascent RNA at promoters and enhancers might lead to reduced YY1 occupancy at these sites. We briefly inhibited transcription elongation with the reversible inhibitor d-rybofuranosylbenzimidazole (DRB) to reduce RNA levels at promoters and enhancers without causing changes in the steady-state levels of YY1 (figs. S10 and S11). DRB treatment reduced transcription at promoters and enhancers, which caused a small but significant decrease in the levels of YY1 at these regions (fig. S10). Super-enhancers are clusters of enhancers that are highly transcribed (20), and DRB treatment had a profound effect on transcription at these sites (fig. S10). Similar results were observed with additional inhibitors (fig. S10). When transcription was allowed to resume after DRB removal, the levels of YY1 increased at promoters and enhancers (Fig. 3B and fig. S10A). These results suggest that nascent RNA produced at promoters and enhancers contributes to YY1 binding to these elements.
Fig. 3 Perturbation of RNA levels affects YY1 binding to DNA.
(A) Cartoon depicting the hypothesis that RNA transcribed from regulatory elements enhances occupancy of these elements by TFs capable of binding both DNA and RNA. (B) (Top) GRO-seq reads (24) at promoters, enhancers, and super-enhancer constituents in cells before (DRB) and after release (Rel) from transcriptional inhibition by DRB. (Bottom) YY1 ChIP-seq reads at promoters, enhancers, and super-enhancer constituents in cells before and after release from transcriptional inhibition by DRB. The increase in YY1 binding after release from DRB inhibition is significant: P < 3.6 × 10−207 for promoters, P < 1.6 × 10−214 for enhancers, and P < 9.8 × 10−37 for super-enhancer constituents. (C) (Top) Box plots depicting RNA-seq data for ribo-depleted total RNA at promoters, enhancers, and super-enhancer constituents in ESCs after targeting with control (Ctrl) or Exosc3 (ExoKD) short hairpin RNA (shRNA). RPKM, reads per kilobase per million mapped reads. (Bottom) Alignment of YY1 ChIP-seq reads at promoters, enhancers, and super-enhancer constituents in ESCs after targeting with control or Exosc3 shRNA. The decrease in YY1 binding in ExoKD ESCs is significant: P < 8.1 × 10−9 for promoters, P < 1.8 × 10−27 for enhancers, and P < 3.3 × 10−5 for super-enhancer constituents. (D) Western blot analysis of YY1, OCT4, and histone H3 levels in whole-cell extracts (WCE), nuclei (N), and a nuclear chromatin preparation before and after treatment with RNase A. Histone H3 serves as a loading control, and OCT4 serves as a negative control. Relative levels of YY1 and OCT4 are noted.
The exosome reduces the levels of enhancer RNAs once they are released from RNA polymerase II (degradation is 3′ to 5′) (21), so knockdown of an exosome component will cause an increase in untethered enhancer RNA, which might titrate some YY1 away from enhancers. Indeed, exosome knockdown led to increased steady-state levels of enhancer RNAs and a decrease in the levels of YY1 bound to enhancers (Fig. 3C and fig. S12). These results are consistent with the model that YY1 binding to DNA is stabilized by binding to nascent RNA.
If YY1 binding to DNA is stabilized by its binding to RNA, then ribonuclease (RNase) treatment of chromatin should reduce YY1 occupancy. Chromatin was extracted from ESC nuclei, and the levels of YY1 in the chromatin preparation were compared with and without RNase A treatment (Fig. 3D). The results show that the levels of YY1 bound to chromatin were significantly decreased when the chromatin preparation was treated with RNase, consistent with the idea that RNA contributes to the stability of YY1 in chromatin.
To test the idea that RNA near regulatory elements can contribute to stable TF occupancy in vivo, we tethered RNA in the vicinity of YY1 binding sites at six different enhancers in ESCs using the CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9) system and determined whether the tethered RNA increases the occupancy of YY1 at these enhancers (Fig. 4). We generated stable murine ESC lines expressing both the catalytically inactive form of bacterial endonuclease Cas9 (dCas9) and a fusion RNA composed of single guide RNA (sgRNA), trans-activating CRISPR RNA (tracrRNA), and a 60–nucleotide (nt) RNA derived from the promoter sequence of Arid1a, compatible with YY1 binding in vitro (fig. S8). For controls, stable cell lines were created that express dCas9 and sgRNA fused to tracrRNA for the six enhancers. Tethering the Arid1a RNA at each enhancer led to increased binding of YY1 to the targeted enhancer, as measured by ChIP–quantitative polymerase chain reaction (qPCR) (Fig. 4B). This elevation in YY1 binding was specific to the targeted locus and the sequence of tethered RNA, as there was no observable increase in YY1 binding at the enhancers not targeted in the same cells (Fig. 4B) or targeted with tethered RNA not compatible with YY1 binding in vitro (fig. S13). These results show that RNA tethered near regulatory elements in vivo can enhance the level of YY1 occupancy at these elements.
Fig. 4 Tethering of RNA adjacent to a YY1 DNA binding site enhances binding of YY1 to the genome in vivo.
(A) Strategy for tethering of RNA in the vicinity of a YY1 binding site at enhancers in vivo. (B) ChIP-qPCR analysis of YY1 binding at six targeted (red) and three nontargeted (blue) enhancers in three independent experiments. The y axis indicates fold change in YY1 binding in ESCs expressing the sgRNA-Arid1a RNA fusion construct relative to cells expressing the control sgRNA targeted to the same locus. The difference in YY1 binding was significant for the targeted enhancers [Klf5 (P = 0.03), Suz12 (P = 0.01), E2f3 (P = 0.01), Nufip2 (P = 0.03), Cnot6 (P = 0.03), and Pias1 (P = 0.01)] but not for the nontargeted enhancers. Error bars indicate SDs from the mean values.
To corroborate the in vivo RNA tethering results, we used a competition EMSA to test whether tethered RNA increases the apparent binding affinity of YY1 to its motif in DNA (fig. S14 and S15). A 30–base pair (bp) labeled DNA probe containing a consensus YY1 binding motif was incubated with recombinant YY1 protein in the presence of increasing concentrations of cold competitor DNA with tethered or untethered RNA, and the amount of radiolabeled DNA that remained bound was quantified (fig. S15). This analysis revealed that DNA containing tethered RNA outcompetes the DNA with untethered RNA for YY1 binding. These results indicate that tethering RNA near the YY1 binding motif in DNA leads to increased binding of YY1 to DNA in vitro.
In summary, our results are consistent with the proposal that RNA enhances the level of YY1 occupancy at active enhancer and promoter-proximal regulatory elements (Fig. 3A). We suggest that nascent RNA produced in the vicinity of enhancer and promoter elements captures dissociating YY1 via relatively weak interactions, which allows this TF to rebind to nearby DNA sequences, thus creating a kinetic sink that increases YY1 occupancy on the regulatory element. The observation that YY1 occupies active enhancers and promoters throughout the ESC genome where RNA is produced, coupled with evidence that YY1 is expressed in all mammalian cells, suggests that this model is general. There are additional DNA binding TFs that can bind RNA (fig. S16) (14), so transcriptional control may generally involve a positive-feedback loop, where YY1 and other TFs stimulate local transcription, and newly transcribed nascent RNA reinforces local TF occupancy. This model helps explain why TFs occupy only the small fraction of their consensus motifs in the mammalian genome where transcription is detected, and it suggests that bidirectional transcription of active enhancers and promoters evolved, in part, to facilitate trapping of TFs at specific regulatory elements. The model also suggests that transcription of regulatory elements produces a positive-feedback loop that may contribute to the stability of gene expression programs in cells. The contribution of this TF trapping mechanism to cellular regulation has yet to be established but will be important to elucidate in future studies because much disease-associated sequence variation occurs in enhancers (20, 22) and may thus affect both DNA and RNA sequences that interact with gene regulators.

Acknowledgments

We thank D. Orlando, C. Lin, V. Saint-André, Z. P. Fan, L. Zhang, and A. Chiu for help with computational analysis and advice. The lentiviral dCas9 and sgRNA expression plasmids are available from Addgene under the Uniform Biological Material Transfer Agreement. This work was supported by NIH grant HG002668 (R.A.Y.), the Hope Funds for Cancer Research (B.J.A.), the Cancer Research Institute (Y.E.G), and Biogen (R.A.Y.). The Whitehead Institute intends to file a patent application that relates to transcription factor trapping by RNA. R.A.Y. is a founder of Syros Pharmaceuticals.

Supplementary Material

Summary

Materials and Methods
Figs. S1 to S16
Tables S1 to S3
References (2550)

Resources

File (sigova.sm.pdf)
File (sigova.sm.revision.1.pdf)

References and Notes

1
Core L. J., Waterfall J. J., Lis J. T., Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters. Science 322, 1845–1848 (2008).
2
Seila A. C., Calabrese J. M., Levine S. S., Yeo G. W., Rahl P. B., Flynn R. A., Young R. A., Sharp P. A., Divergent transcription from active promoters. Science 322, 1849–1851 (2008).
3
Sigova A. A., Mullen A. C., Molinie B., Gupta S., Orlando D. A., Guenther M. G., Almada A. E., Lin C., Sharp P. A., Giallourakis C. C., Young R. A., Divergent transcription of long noncoding RNA/mRNA gene pairs in embryonic stem cells. Proc. Natl. Acad. Sci. U.S.A. 110, 2876–2881 (2013).
4
Kim T. K., Hemberg M., Gray J. M., Costa A. M., Bear D. M., Wu J., Harmin D. A., Laptewicz M., Barbara-Haley K., Kuersten S., Markenscoff-Papadimitriou E., Kuhl D., Bito H., Worley P. F., Kreiman G., Greenberg M. E., Widespread transcription at neuronal activity-regulated enhancers. Nature 465, 182–187 (2010).
5
Wang D., Garcia-Bassets I., Benner C., Li W., Su X., Zhou Y., Qiu J., Liu W., Kaikkonen M. U., Ohgi K. A., Glass C. K., Rosenfeld M. G., Fu X. D., Reprogramming transcription by distinct classes of enhancers functionally defined by eRNA. Nature 474, 390–394 (2011).
6
Melo C. A., Drost J., Wijchers P. J., van de Werken H., de Wit E., Oude Vrielink J. A. F., Elkon R., Melo S. A., Léveillé N., Kalluri R., de Laat W., Agami R., eRNAs are required for p53-dependent enhancer activity and gene transcription. Mol. Cell 49, 524–535 (2013).
7
Lai F., Orom U. A., Cesaroni M., Beringer M., Taatjes D. J., Blobel G. A., Shiekhattar R., Activating RNAs associate with Mediator to enhance chromatin architecture and transcription. Nature 494, 497–501 (2013).
8
Lam M. T., Cho H., Lesch H. P., Gosselin D., Heinz S., Tanaka-Oishi Y., Benner C., Kaikkonen M. U., Kim A. S., Kosaka M., Lee C. Y., Watt A., Grossman T. R., Rosenfeld M. G., Evans R. M., Glass C. K., Rev-Erbs repress macrophage gene expression by inhibiting enhancer-directed transcription. Nature 498, 511–515 (2013).
9
Li W., Notani D., Ma Q., Tanasa B., Nunez E., Chen A. Y., Merkurjev D., Zhang J., Ohgi K., Song X., Oh S., Kim H. S., Glass C. K., Rosenfeld M. G., Functional roles of enhancer RNAs for oestrogen-dependent transcriptional activation. Nature 498, 516–520 (2013).
10
Kaikkonen M. U., Spann N. J., Heinz S., Romanoski C. E., Allison K. A., Stender J. D., Chun H. B., Tough D. F., Prinjha R. K., Benner C., Glass C. K., Remodeling of the enhancer landscape during macrophage activation is coupled to enhancer transcription. Mol. Cell 51, 310–325 (2013).
11
Mousavi K., Zare H., Dell’orso S., Grontved L., Gutierrez-Cruz G., Derfoul A., Hager G. L., Sartorelli V., eRNAs promote transcription by establishing chromatin accessibility at defined genomic loci. Mol. Cell 51, 606–617 (2013).
12
Di Ruscio A., Ebralidze A. K., Benoukraf T., Amabile G., Goff L. A., Terragni J., Figueroa M. E., De Figueiredo Pontes L. L., Alberich-Jorda M., Zhang P., Wu M., D’Alò F., Melnick A., Leone G., Ebralidze K. K., Pradhan S., Rinn J. L., Tenen D. G., DNMT1-interacting RNAs block gene-specific DNA methylation. Nature 503, 371–376 (2013).
13
Schaukowitch K., Joo J. Y., Liu X., Watts J. K., Martinez C., Kim T. K., Enhancer RNA facilitates NELF release from immediate early genes. Mol. Cell 56, 29–42 (2014).
14
Cassiday L. A., Maher L. J., Having it both ways: Transcription factors that bind DNA and RNA. Nucleic Acids Res. 30, 4118–4126 (2002).
15
Jeon Y., Lee J. T., YY1 tethers Xist RNA to the inactive X nucleation center. Cell 146, 119–133 (2011).
16
Gordon S., Akopyan G., Garban H., Bonavida B., Transcription factor YY1: Structure, function, and therapeutic implications in cancer biology. Oncogene 25, 1125–1142 (2006).
17
Flynn R. A., Almada A. E., Zamudio J. R., Sharp P. A., Antisense RNA polymerase II divergent transcripts are P-TEFb dependent and substrates for the RNA exosome. Proc. Natl. Acad. Sci. U.S.A. 108, 10460–10465 (2011).
18
Preker P., Nielsen J., Kammler S., Lykke-Andersen S., Christensen M. S., Mapendano C. K., Schierup M. H., Jensen T. H., RNA exosome depletion reveals transcription upstream of active human promoters. Science 322, 1851–1854 (2008).
19
Houbaviy H. B., Usheva A., Shenk T., Burley S. K., Cocrystal structure of YY1 bound to the adeno-associated virus P5 initiator. Proc. Natl. Acad. Sci. U.S.A. 93, 13577–13582 (1996).
20
Hnisz D., Abraham B. J., Lee T. I., Lau A., Saint-André V., Sigova A. A., Hoke H. A., Young R. A., Super-enhancers in the control of cell identity and disease. Cell 155, 934–947 (2013).
21
Lubas M., Andersen P. R., Schein A., Dziembowski A., Kudla G., Jensen T. H., The human nuclear exosome targeting complex is loaded onto newly synthesized RNA to direct early ribonucleolysis. Cell Reports 10, 178–192 (2015).
22
Maurano M. T., Humbert R., Rynes E., Thurman R. E., Haugen E., Wang H., Reynolds A. P., Sandstrom R., Qu H., Brody J., Shafer A., Neri F., Lee K., Kutyavin T., Stehling-Sun S., Johnson A. K., Canfield T. K., Giste E., Diegel M., Bates D., Hansen R. S., Neph S., Sabo P. J., Heimfeld S., Raubitschek A., Ziegler S., Cotsapas C., Sotoodehnia N., Glass I., Sunyaev S. R., Kaul R., Stamatoyannopoulos J. A., Systematic localization of common disease-associated variation in regulatory DNA. Science 337, 1190–1195 (2012).
23
Whyte W. A., Orlando D. A., Hnisz D., Abraham B. J., Lin C. Y., Kagey M. H., Rahl P. B., Lee T. I., Young R. A., Master transcription factors and mediator establish super-enhancers at key cell identity genes. Cell 153, 307–319 (2013).
24
Wang L., Zhou Y., Xu L., Xiao R., Lu X., Chen L., Chong J., Li H., He C., Fu X. D., Wang D., Molecular basis for 5-carboxycytosine recognition by RNA polymerase II elongation complex. Nature 523, 621–625 (2015).
25
Vella P., Barozzi I., Cuomo A., Bonaldi T., Pasini D., Yin Yang 1 extends the Myc-related transcription factors network in embryonic stem cells. Nucleic Acids Res. 40, 3403–3418 (2012).
26
Kim J., Chu J., Shen X., Wang J., Orkin S. H., An extended transcriptional network for pluripotency of embryonic stem cells. Cell 132, 1049–1061 (2008).
27
Boyer L. A., Plath K., Zeitlinger J., Brambrink T., Medeiros L. A., Lee T. I., Levine S. S., Wernig M., Tajonar A., Ray M. K., Bell G. W., Otte A. P., Vidal M., Gifford D. K., Young R. A., Jaenisch R., Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441, 349–353 (2006).
28
Schmieder R., Edwards R., Quality control and preprocessing of metagenomic datasets. Bioinformatics 27, 863–864 (2011).
29
Kim J., Cantor A. B., Orkin S. H., Wang J., Use of in vivo biotinylation to study protein-protein and protein-DNA interactions in mouse embryonic stem cells. Nat. Protoc. 4, 506–517 (2009).
30
Langmead B., Trapnell C., Pop M., Salzberg S. L., Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25 (2009).
31
Zhang Y., Liu T., Meyer C. A., Eeckhoute J., Johnson D. S., Bernstein B. E., Nusbaum C., Myers R. M., Brown M., Li W., Liu X. S., Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9, R137 (2008).
32
Kent W. J., Sugnet C. W., Furey T. S., Roskin K. M., Pringle T. H., Zahler A. M., Haussler D., The human genome browser at UCSC. Genome Res. 12, 996–1006 (2002).
33
Grant C. E., Bailey T. L., Noble W. S., FIMO: Scanning for occurrences of a given motif. Bioinformatics 27, 1017–1018 (2011).
34
Bryne J. C., Valen E., Tang M. H., Marstrand T., Winther O., da Piedade I., Krogh A., Lenhard B., Sandelin A., JASPAR, the open access database of transcription factor-binding profiles: New content and tools in the 2008 update. Nucleic Acids Res. 36 (suppl. 1), D102–D106 (2008).
35
Jolma A., Yan J., Whitington T., Toivonen J., Nitta K. R., Rastas P., Morgunova E., Enge M., Taipale M., Wei G., Palin K., Vaquerizas J. M., Vincentelli R., Luscombe N. M., Hughes T. R., Lemaire P., Ukkonen E., Kivioja T., Taipale J., DNA-binding specificities of human transcription factors. Cell 152, 327–339 (2013).
36
Trapnell C., Pachter L., Salzberg S. L., TopHat: Discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105–1111 (2009).
37
Wang L., Wang S., Li W., RSeQC: Quality control of RNA-seq experiments. Bioinformatics 28, 2184–2185 (2012).
38
Lovén J., Orlando D. A., Sigova A. A., Lin C. Y., Rahl P. B., Burge C. B., Levens D. L., Lee T. I., Young R. A., Revisiting global gene expression analysis. Cell 151, 476–482 (2012).
39
Lin C. Y., Lovén J., Rahl P. B., Paranal R. M., Burge C. B., Bradner J. E., Lee T. I., Young R. A., Transcriptional amplification in tumor cells with elevated c-Myc. Cell 151, 56–67 (2012).
40
Quinlan A. R., Hall I. M., BEDTools: A flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842 (2010).
41
Kopylova E., Noé L., Touzet H., SortMeRNA: Fast and accurate filtering of ribosomal RNAs in metatranscriptomic data. Bioinformatics 28, 3211–3217 (2012).
42
Kent W. J., Zweig A. S., Barber G., Hinrichs A. S., Karolchik D., BigWig and BigBed: Enabling browsing of large distributed datasets. Bioinformatics 26, 2204–2207 (2010).
43
Jangi M., Boutz P. L., Paul P., Sharp P. A., Rbfox2 controls autoregulation in RNA-binding protein networks. Genes Dev. 28, 637–651 (2014).
44
Martin M., Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal 17, 10–12 (2011).
45
Langmead B., Salzberg S. L., Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357–359 (2012).
46
Li H., Handsaker B., Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R.1000 Genome Project Data Processing Subgroup, The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).
47
Cernilogar F. M., Onorati M. C., Kothe G. O., Burroughs A. M., Parsi K. M., Breiling A., Lo Sardo F., Saxena A., Miyoshi K., Siomi H., Siomi M. C., Carninci P., Gilmour D. S., Corona D. F. V., Orlando V., Chromatin-associated RNA interference components contribute to transcriptional regulation in Drosophila. Nature 480, 391–395 (2011).
48
Mullen A. C., Orlando D. A., Newman J. J., Lovén J., Kumar R. M., Bilodeau S., Reddy J., Guenther M. G., DeKoter R. P., Young R. A., Master transcription factors determine cell-type-specific responses to TGF-β signaling. Cell 147, 565–576 (2011).
49
Wang H., Yang H., Shivalila C. S., Dawlaty M. M., Cheng A. W., Zhang F., Jaenisch R., One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910–918 (2013).
50
Kearns N. A., Genga R. M., Enuameh M. S., Garber M., Wolfe S. A., Maehr R., Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development 141, 219–223 (2014).

(0)eLetters

eLetters is an online forum for ongoing peer review. Submission of eLetters are open to all. eLetters are not edited, proofread, or indexed. Please read our Terms of Service before submitting your own eLetter.

Log In to Submit a Response

No eLetters have been published for this article yet.

Information & Authors

Information

Published In

Science
Volume 350 | Issue 6263
20 November 2015

Article versions

You are viewing the most recent version of this article.

Submission history

Received: 29 August 2015
Accepted: 14 October 2015
Published in print: 20 November 2015

Permissions

Request permissions for this article.

Acknowledgments

We thank D. Orlando, C. Lin, V. Saint-André, Z. P. Fan, L. Zhang, and A. Chiu for help with computational analysis and advice. The lentiviral dCas9 and sgRNA expression plasmids are available from Addgene under the Uniform Biological Material Transfer Agreement. This work was supported by NIH grant HG002668 (R.A.Y.), the Hope Funds for Cancer Research (B.J.A.), the Cancer Research Institute (Y.E.G), and Biogen (R.A.Y.). The Whitehead Institute intends to file a patent application that relates to transcription factor trapping by RNA. R.A.Y. is a founder of Syros Pharmaceuticals.

Authors

Affiliations

Alla A. Sigova
Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA.
Brian J. Abraham
Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA.
Xiong Ji
Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA.
Benoit Molinie
Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114, USA.
Nancy M. Hannett
Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA.
Yang Eric Guo
Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA.
Mohini Jangi
Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142, USA.
David H. Koch Institute for Integrative Cancer Research, Cambridge, MA 02140, USA.
Present address: Biogen, Cambridge, MA 02142, USA.
Cosmas C. Giallourakis
Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114, USA.
Phillip A. Sharp
Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142, USA.
David H. Koch Institute for Integrative Cancer Research, Cambridge, MA 02140, USA.
Richard A. Young [email protected]
Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA.
Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142, USA.

Notes

Corresponding author. E-mail: [email protected]

Metrics & Citations

Metrics

Article Usage
Altmetrics

Citations

Export citation

Select the format you want to export the citation of this publication.

Cited by

  1. FTO mediates LINE1 m6A demethylation and chromatin regulation in mESCs and mouse development, Science, 376, 6596, (968-973), (2022)./doi/10.1126/science.abe9582
    Abstract
  2. XLID syndrome gene Med12 promotes Ig isotype switching through chromatin modification and enhancer RNA regulation, Science Advances, 8, 47, (2022)./doi/10.1126/sciadv.add1466
    Abstract
  3. Noncoding RNAs Set the Stage for RNA Polymerase II Transcription, Trends in Genetics, 37, 3, (279-291), (2021).https://doi.org/10.1016/j.tig.2020.09.013
    Crossref
  4. The dystonia gene THAP1 controls DNA double-strand break repair choice, Molecular Cell, 81, 12, (2611-2624.e10), (2021).https://doi.org/10.1016/j.molcel.2021.03.034
    Crossref
  5. Transcriptionally active enhancers in human cancer cells, Molecular Systems Biology, 17, 1, (2021).https://doi.org/10.15252/msb.20209873
    Crossref
  6. Biochemical Timekeeping Via Reentrant Phase Transitions, Journal of Molecular Biology, 433, 12, (166794), (2021).https://doi.org/10.1016/j.jmb.2020.166794
    Crossref
  7. RNA-Mediated Feedback Control of Transcriptional Condensates, Cell, 184, 1, (207-225.e24), (2021).https://doi.org/10.1016/j.cell.2020.11.030
    Crossref
  8. CRED9: a differentially expressed elncRNA regulates expression of transcription factor CEBPA, RNA, 27, 8, (891-906), (2021).https://doi.org/10.1261/rna.078752.121
    Crossref
  9. Role of mammalian long non-coding RNAs in normal and neuro oncological disorders, Genomics, 113, 5, (3250-3273), (2021).https://doi.org/10.1016/j.ygeno.2021.07.015
    Crossref
  10. Intergenic RNA mainly derives from nascent transcripts of known genes, Genome Biology, 22, 1, (2021).https://doi.org/10.1186/s13059-021-02350-x
    Crossref
  11. See more
Loading...

View Options

View options

PDF format

Download this article as a PDF file

Download PDF

Check Access

Log in to view the full text

AAAS ID LOGIN

AAAS login provides access to Science for AAAS Members, and access to other journals in the Science family to users who have purchased individual subscriptions.

Log in via OpenAthens.
Log in via Shibboleth.
More options

Register for free to read this article

As a service to the community, this article is available for free. Login or register for free to read this article.

Purchase this issue in print

Buy a single issue of Science for just $15 USD.

Media

Figures

Multimedia

Tables

Share

Share

Share article link

Share on social media